Targeting yellow with the act-cas9 flies

Fillip Port, Madalena Reimão-Pinto and Simon Bullock

MRC-Laboratory of Molecular Biology, Cambridge, UK

While making the cas9 transgenic lines we were very keen to test the system, so we started our first experiment with the very first transformants. Our injection of the act5-cas9 construct was quite successful and we got a good number of transgenic flies, which were used to set up a little cage for injections of gRNAs. That means that this experiment did not use the act-cas9 stock, but rather heterozygous females crossed to non-transgenic males (see crossing scheme). It also was a small scale experiment, so what we describe here are just our general observations.

YellowFigureUpdatedWe used a mix of two gRNAs, which have been previously described by others (Gratz et al., Genetics, 2013). The target sequences are: yellow gRNA1: GCGATATAGTTGGAGCCAGC (YE1 in Gratz et al.) and yellow gRNA2: GGTTCAGTGTTCGGGTAATC (Y5′ in Gratz et al.). The gRNAs were in vitro transcribed and mixed at a concentration of around 200ng/µl each.

Around 50% of the injected flies had yellow mutant clones (see an example above). These clones were usually small and predominantly in the abdomen. Interestingly, we did also recover non-transgenic flies with yellow clones. This indicates that maternal contribution of cas9 from heterozygous mothers is sufficient to mediate cleavage. This is particularly relevant when you plan to mutagenise genes on the X chromosome, as it would allow targeting of a X chromosome that does not contain the cas9 transgene.

We then crossed males with yellow mutant clones to virgin females homozygous for y1 and searched for yellow mutant female offspring. Most crosses gave yellow females with a frequency ranging between 1% and 50% of the total number of females. We sequenced the target site of a few of these flies and found the expected indels at the predicted cut sites.

 

Gratz SJ, Cummings AM, Nguyen JH, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O’Connor-Giles KM. Genome Engineering of Drosophila with the CRISPR RNA-Guided CAS9 Nuclease. Genetics. 2013 Aug; 194(4): 1029-35